icon_100_genome_editing

CRISPR-Cas12a (Cpf1) genome editing

Expand your options for genome editing with the Alt-R® CRISPR-Cas12a System.

The Alt-R CRISPR-Cas12a System allows targeting of alternative sites that are not available to the CRISPR-Cas9 System and produces a staggered cut with a 5′ overhang.

  • Enables genome editing in organisms with AT-rich genomes
  • Allows interrogation of additional genomic regions compared to Cas9
  • Requires simple complexing of crRNA with the Cas12a protein—no tracrRNA needed
  • Permits efficient delivery of the RNP into cells by electroporation

Ordering

We recommend using Alt-R A.s. Cas12a (Cpf1) Nuclease V3 combined with the Alt-R CRISPR-Cas12a (Cpf1) crRNA to generate a ribonucleoprotein (RNP) editing complex. The Alt-R Cas12a (Cpf1) Electroporation Enhancer is critical for optimal delivery by electroporation and is recommended for all experiments using this transfection method. View the Alt-R CRISPR-Cas12a (Cpf1) System User Guide for guidance on electroporation and delivery of the RNP into your cell lines.

CRISPR-Cas12a (Cpf1) crRNA

Customer-defined crRNA that will bind to 21–24 bases opposite to the TTTV, PAM sequence. Prices shown are for each crRNA. Plates require a minimum order of 24 crRNAs.

ProductPricingLength
Alt-R® CRISPR-Cpf1 crRNA, 2 nmol$115.00 SGD20 - 24 Bases
Alt-R® CRISPR-Cpf1 crRNA, 10 nmol$150.00 SGD20 - 24 Bases
ProductPricingLength96 Well384 Well
Alt-R® CRISPR-Cpf1 crRNA, 2 nmol, Plate$96.00 SGD / well20 - 24 BasesOrderOrder
Alt-R® CRISPR-Cpf1 crRNA, 10 nmol, Plate$130.00 SGD / well20 - 24 BasesOrderOrder

Unlike S. pyogenes Cas9, which cleaves most potential NGG PAM sites to some degree, some of the tested TTTV sites show no cleavage by A.s. Cas12a nuclease. We recommend using positive control crRNAs (see below for suggested sequences) to establish that your cells can be edited by Cas12a1. In addition, we recommend testing 3 or more crRNAs per target gene.

Control crRNAs for Cas12a (Cpf1)

Positive controls

To order, copy and paste the appropriate sequence in the CRISPR-Cas12a (Cpf1) crRNA Oligo Entry tool:

Human HPRT1, Cas12a Positive Control crRNA: GGTTAAAGATGGTTAAATGAT

Mouse Hprt, Cas12a Positive Control crRNA: GGATGTTAAGAGTCCCTATCT

Rat Hprt1, Cas12a Positive Control crRNA: ATGCTTAAGAGGTATTTGTTA

Negative controls

To order, copy and paste the appropriate sequence in the CRISPR-Cas12a (Cpf1) crRNA Oligo Entry tool:

Cas12a Negative Control crRNA #1: CGTTAATCGCGTATAATACGG

Cas12a Negative Control crRNA #2: CATATTGCGCGTATAGTCGCG

Cas12a Negative Control crRNA #3: GGCGCGTATAGTCGCGCGTAT

Custom CRISPR solutions

Don’t see what you’re looking for? We are continually expanding our CRISPR product line, and we may have what you need. If you are interested in custom libraries, other CRISPR enzymes, formulations, or other CRISPR tools contact our CRISPR experts today to discuss customized solutions for your research: CRISPR@idtdna.com.

Alt-R CRISPR-Cas12a System

Simple, 2-step delivery of ribonucleoprotein complexes (crRNA:Cas12a)

Figure 1. Overview of Alt-R CRISPR-Cas12a System experiments for ribonucleoprotein (RNP) delivery by electroporation.

CRISPR-Cas12a genome editing method uses the Cas12a endonuclease to generate double-stranded breaks that contain a staggered 5′ overhang. Cas12a only requires a single CRISPR RNA (crRNA) to specify the DNA target sequence (Figure 1). After cleavage, DNA is then repaired by non-homologous end-joining (NHEJ) or homology-directed recombination (HDR), resulting in a modified sequence. Alt-R CRISPR-Cas12a reagents provide essential, optimized tools needed to use this pathway for genome editing research. A brief comparison of CRISPR-Cas9 and CRISPR-Cas12a is provided at the end of this section.

Alt-R CRISPR-Cas12a System
Required components
Alt-R CRISPR-Cas12a (Cpf1) crRNATarget-specific RNA oligo, custom synthesized based on your sequence
Alt-R A.s. Cas12a (Cpf1) Nuclease V3
  • Protein that binds the Cas12a crRNA, creating an experiment-ready, active ribonucleoprotein (RNP) complex
  • Contains nuclear localization signals (NLSs) for optimal performance
Alt-R Cas12a (Cpf1) Electroporation EnhancerCas12a-specific carrier DNA required for efficient electroporation of the RNP
Related reagents and kits
Alt-R HDR EnhancerFor improved rates of homology-directed repair
Cas12a positive controlsOrder as custom crRNAs or oligos
  • HPRT crRNAs (human, mouse, or rat): To show that Cas12a editing is occurring in your system during experimental optimization or troubleshooting
  • HPRT PCR primers (human, mouse, or rat): To detect genome editing in experiments with HPRT crRNAs; for use with the Alt-R Genome Editing Detection Kit
Alt-R Genome Editing Detection KitFor mutation detection and estimating editing efficiency

Components for genome editing

Cas12a endonuclease from Acidaminococcus sp. BV3L6 along with a crRNA is capable of mediating genome editing in mammalian cells (Figure 2). The Alt-R CRISPR-Cas12a System includes 3 main components: an optimized crRNA, A.s. Cas12a endonuclease, and an electroporation enhancer. While electroporation of Cas12a endonuclease as part of an RNP is the preferred method, the Alt-R CRISPR-Cas12a crRNA is also compatible with A.s. Cas12a from any source, including cells that stably express A.s. Cas12a endonuclease.

Figure 2. Components of the Alt-R CRISPR-Cas12a System for directing Cas12a endonuclease to genomic targets. Alt-R Cas12a (Cpf1) crRNA forms a complex with Cas12a endonuclease to guide targeted cleavage of genomic DNA. The cleavage site is specified by the protospacer element of the crRNA (thick green bar). The crRNA protospacer element recognizes 21 nt on the opposite strand of the TTTV PAM site. The PAM site must be present immediately upstream of the protospacer element for cleavage to occur. PAM = protospacer adjacent motif; V = A, C, or G

Alt-R CRISPR-Cas12a (Cpf1) crRNA and design tips

The Alt-R CRISPR-Cas12a (Cpf1) crRNA is a single, 40–44 base, guide RNA, comprised of a 20 base constant region (loop domain) and a 20–24 base target-specific region (protospacer domain). We typically recommend a 21 base protospacer domain for optimal activity. All Alt-R CRISPR-Cas12a (Cpf1) crRNAs are synthesized with proprietary chemical modifications, which protect the crRNA from degradation by cellular RNases and further improve on-target editing performance. For crRNAs used with A.s. Cas12a, identify locations in your target region with the protospacer adjacent motif (PAM) sequence, TTTV, where V is A, C, or G. Your Alt-R CRISPR-Cas12a (Cpf1) crRNA will bind to the DNA strand opposite to the PAM sequence (Figure 2). Do not include the PAM sequence in your crRNA design. An example of a correct crRNA sequence is shown in Figure 3.

After you enter your 20–24 base target sequence, 20 additional bases and the necessary modifications will automatically be added by the order entry system for a total of 40–44 RNA bases. These additional bases and modifications are necessary to create a complete Alt-R CRISPR-Cas12a (Cpf1) crRNA. The system will also convert the final sequence to RNA—enter DNA bases only into the ordering tool (Figure 3).

Figure 3. How to enter your Cas12a (Cpf1) crRNA target sequence. Because the crRNA recognizes and binds 21 bases on the DNA strand opposite from the TTTV sequence of the PAM site, order your crRNA by entering the 20–24 bases downstream of the PAM site, in the forward orientation as shown. Enter only DNA bases into the order entry tool. If you are pasting your CRISPR target site from an online design tool, make sure you verify the correct strand orientation. Do not include the PAM site in your design. Common incorrect design examples are shown in red. PAM = protospacer adjacent motif; V = A, C, or G

Alt-R A.s. Cas12a (Cpf1) nuclease

Alt-R A.s. Cas12a (Cpf1) Nuclease V3 enzyme is a high purity, recombinant Acidaminococcus sp. Cas12a. The enzymes include nuclear localization sequences (NLSs) and C-terminal 6-His tags. The Cas12a enzyme must be combined with a crRNA to produce a functional, target-specific editing complex. For the best editing, combine Alt-R A.s. Cas12a (Cpf1) Nuclease V3 enzyme with optimized Alt-R CRISPR-Cas12a (Cpf1) crRNA in equimolar amounts.

In contrast to Streptococcus pyogenes Cas9, which recognizes an NGG PAM sequence, the A.s. Cas12a PAM sequence is TTTV, which permits targeting of DNA sequences in AT-rich regions of the genome.

Alt-R Cas12a (Cpf1) Electroporation Enhancer

The Alt-R Cas12a (Cpf1) Electroporation Enhancer is a Cas12a-specific carrier DNA that is optimized to work with the Amaxa® Nucleofector® device (Lonza) and the Neon® Transfection System (Thermo Fisher) for increased transfection efficiency and therefore, increased genome editing efficiency.Alt-R CRISPR-Cas9 Control crRNAs and PCR Assays

Alt-R HDR Enhancer

Alt-R HDR Enhancer is a small molecule compound that increases homology-directed repair. Alt-R HDR Enhancer exhibits its activity in multiple cell lines, including both adherent and suspension cell lines. Its activity is independent of the enzyme employed; for example, it can be used either with Alt-R S.p. Cas9 Nuclease V3 or Alr-R A.s. Cas12a (Cpf1) Nuclease V3.

Positive controls

crRNAs

Positive control crRNAs can be used to show that Cas12a editing is occurring in your experiments, which can be useful when you are optimizing RNP delivery conditions or if you need to troubleshoot your experiments.

Attention: Unlike S. pyogenes Cas9, which cleaves most potential NGG PAM sites to some degree, some of the tested TTTV sites show no cleavage by A.s. Cas12a nuclease. We recommend using positive control crRNAs to establish that your cells can be edited by Cas12a. In addition, we suggest testing 3 or more crRNAs per target gene.

Our scientists have designed and tested positive control crRNAs targeting HPRT (Figure 4). To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Human HPRT1, Cas12a Positive Control crRNA: GGTTAAAGATGGTTAAATGAT

Mouse Hprt, Cas12a Positive Control crRNA: GGATGTTAAGAGTCCCTATCT

Rat Hprt1, Cas12a Positive Control crRNA: ACCGCCCCCCCCATACCCCAA

PCR primers

Our scientists have also designed and tested PCR primers (Alt-R HPRT PCR Primer Mixes for human, mouse, or rat) for use with the Alt-R Genome Editing Detection Kit to detect editing or estimate editing efficiency in samples transfected with the positive control HPRT crRNAs.

Figure 4. Sample data from T7 endonuclease I (T7EI) assays of samples transfected with Cas12a HPRT Positive Controls. Genomic DNA from CRISPR-Cas12a edited human, mouse, and rat HPRT controls were PCR amplified, digested using T7EI, and run on the Fragment Analyzer™ system (Advanced Analytical Technologies, Inc.). Reference standard bands at 5000 bp (upper marker) and 35 bp (lower marker) are used to align the gel and analyze the results. Estimated band sizes for the cut and uncut positive control amplicons are listed in the table. Cell lines used were HEK-293 (human), Hepa1-6 (mouse), and RG2 (rat). PCR annealing temperatures for human and mouse primers is 67°C and for rat primers is 64°C.

Negative controls

Negative control crRNAs are important for showing that transfection of the RNP complex is not responsible for observed phenotypes. Amplification of DNA from these negative control samples with your experimental primers and cycling conditions should result in only full-length products with the Alt-R Genome Editing Detection Kit (i.e., in a T7EI assay). Note, that this result does not rule out off-target effects of your experimental crRNA.

Our scientists have computationally designed and tested negative control crRNAs to be non-targeting in human, mouse, and rat genomes. To order, copy and paste the appropriate sequence in the Cas12a (Cpf1) crRNA ordering page:

Cas12a Negative Control crRNA #1: CGTTAATCGCGTATAATACGG

Cas12a Negative Control crRNA #2: CATATTGCGCGTATAGTCGCG

Cas12a Negative Control crRNA #3: GGCGCGTATAGTCGCGCGTAT

Comparison of CRISPR genome editing using Cas9 vs. Cas12a (Cpf1)

 Cas9 systemCas12a system
ApplicationsGeneral genome editing
  • For species with AT-rich genomes
  • For regions with limiting design space for use of the CRISPR-Cas9 system
Ribonucleoprotein components
  • gRNA options:
    1. crRNA and tracrRNA
    2. sgRNA
  • Cas9 endonuclease
  • crRNA
  • Cas12a endonuclease
Variants
  • Wild-type
  • HiFi
  • Nickases (H840A and D10A)
Wild-type
Cas9 crRNA:tracrRNA (option 1)

crRNA

  • Native: 42 nt
  • Alt-R: 35–36 nt (36 nt recommended)

tracrRNA

  • Native: 89 nt
  • Alt-R: 67 nt
Cas9 sgRNA (option 2)
  • Alt-R: 99–100 nt (100 nt recommended)
Cas12a crRNA
  • Native: 42–44 nt
  • Alt-R: 40–44 nt (41 nt recommended)
CRISPR enzyme
  • Class 2, Cas type II
  • M.W.*: 162,200 g/mol
  • Endonuclease domains: RuvC-like and HNH
  • Class 2, Cas type V
  • M.W.*: 156,400 g/mol
  • Endonuclease domain: RuvC-like only
DNA cleavage
  • Wild-type and HiFi: Blunt-ended cut 3 bases upstream of the protospacer sequence
  • D10A nickase with paired gRNAs: 5′ overhang
  • H840A nickase with paired gRNAs: 3′ overhang
  • PAM site often destroyed during genome editing
  • 5′ overhanging cut on the 5′ side of the protospacer sequence
  • PAM site may be preserved after genome editing
PAM sequenceNGGTTTV
Current recommendations for Alt-R RNP delivery
  • Lipid-mediated transfection
  • Electroporation (Alt-R enhancer recommended)
  • Microinjection
  • Electroporation (Alt-R enhancer required)
  • Microinjection

* Molecular weight of Alt-R nuclease
N = any base; V = A, C, or G

This comparison table is available for download (see page 2).

Alt-R HDR Enhancer improves HDR efficiency

The addition of the HDR enhancer to CRISPR-Cas12a editing experiments increases HDR efficiency (Figure 1).

Figure 1. Alt-R HDR Enhancer improves HDR mediated by A.s. Cas12a (Cpf1). 5 µM of Alt-R Cas12a RNP, together with 3 µM of Alt-R Cas12a Electroporation Enhancer and 3 µM of single-stranded DNA template (Ultramer oligos, IDT) were electroporated into Jurkat cells using the Neon Transfection System (Thermo Fisher). After electroporation, cells were plated in media that contained either 30 µM of Alt-R HDR enhancer (gray bar), or equal volume of DMSO solution as the negative control (light blue bar). A “no treatment” control group that received media alone was also included in the experiment (dark blue bar). HDR efficiency was assessed 48–72 hr after electroporation by EcoRI cleavage of the PCR products amplified from the target locus. HDR = homology-directed repair; DMSO = dimethyl sulfoxide.

Improved Alt-R Cas12a V3 enzyme dramatically increases overall editing efficiency

To enhance performance, we introduced multiple modifications to the Cas12a protein that resulted in remarkable improvement in overall editing efficiency. These changes resulted in remarkable improvement in overall editing efficiency of the Cas12a protein. Figure 2 demonstrates the difference in total editing efficiency between the original Alt-R A.s. Cpf1 Nuclease 2NLS and modified Alt-R A.s. Cas12a Nuclease V3 on 96 sites distributed over 24 genes.

Figure 2. Optimal genome editing efficiency with a novel Cas12a (formerly known as Cpf1) endonuclease. (A) 96 sites distributed over 24 genes were targeted by ribonucleoprotein (RNP) complexes formed with Alt-R CRISPR-Cpf1 (Cas12a) crRNA:tracrRNA together with either Alt-R A.s. Cas12a Nuclease V3 (dark blue) or Alt-R A.s. Cpf1 Nuclease 2NLS (light blue). RNPs were delivered at 5 µM concentration together with 3 µM Alt-R Cpf1 (Cas12a) Electroporation Enhancer using the Amaxa Nucleofector (Lonza). Total editing efficiencies were determined 48 hours after electroporation by NGS-based targeted sequencing. Target sites are ranked based on increasing editing efficiency. (B) Aggregated editing efficiencies from using Alt-R A.s. Cas12a Nuclease V3 (dark blue) are compared to that of Alt-R A.s. Cpf1 Nuclease 2NLS (light blue) at the 96 loci shown in Figure 1A.

PAM sites for Cas12a include TTTA, TTTC, and TTTG

A.s. Cas12a nuclease has a lower rate of cleavage for its PAM sequences than S. pyogenes Cas9, which cleaves most NGG PAM sites to some degree. Our scientists have found that crRNAs that have TTTA, TTTC, and TTTG PAM sequences tend to be more functional than crRNAs that have a TTTT PAM sequence (Figure 3).

Figure 3. Maximize successful CRISPR-Cas12a genome editing by using TTTA, TTTC, or TTTG as the PAM site. HEK-293 cells were transfected with ribonucleoprotein [RNP: Alt-R A.s. Cpf1 Nuclease 2 NLS complexed with Alt-R CRISPR-Cas12a (Cpf1) crRNA] as instructed in the Alt-R CRISPR-Cas12a (Cpf1) User Guide—RNP electroporation, Amaxa Nucleofector system. TTTN sites from 6 genes were used to design 232 Alt-R CRISPR-Cas12a (Cpf1) crRNAs. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI endonuclease assays. PAM = protospacer adjacent motif (Cas12a PAM sequence is TTTV, where V = A, C, or G); N = any base

The electroporation enhancer is required for efficient genome editing with the CRISPR-Cas12a system

Our research shows that not all Cas12a PAM sequences are active sites for genome editing. We recommend that you test 3 or more PAM sites in your region of interest and include the Alt-R Cas12a (Cpf1) Electroporation Enhancer to achieve efficient genome editing (Figure 4). The electroporation enhancer is a non-targeting carrier DNA that shows no integration into the target site based on next generation sequencing experiments.

Figure 4. Alt-R Cas12a (Cpf1) Electroporation Enhancer is required for efficient CRISPR editing in ribonucleoprotein (RNP) electroporation experiments. HEK-293 cells were transfected with 5 µM RNP [Alt-R A.s. Cpf1 Nuclease 2 NLS complexed with Alt-R CRISPR-Cas12a (Cpf1) crRNA] as instructed in the Alt-R CRISPR-Cas12a (Cpf1) User Guide—RNP electroporation, Amaxa Nucleofector system (available at www.idtdna.com/CRISPR-Cpf1). 12 Cas12a PAM sites in the HPRT gene were targeted by Alt-R CRISPR-Cas12a (Cpf1) crRNAs. The electroporation reactions contained either no (dark blue) or 3 µM (light blue) Alt-R Cas12a (Cpf1) Electroporation Enhancer. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI assays. PAM = protospacer adjacent motif (Cas12a PAM sequence is TTTV); x-axis: numbers specify gene locations; S = sense strand; AS = antisense strand.

Optimized Cas12a (Cpf1) crRNA length improves gene editing performance

Systematic variation of crRNA length led to the development of the Alt-R CRISPR-Cas12a (Cpf1) crRNA, which shows improved gene editing in mammalian cells. Overall, crRNAs containing 21 nt protospacers provided the highest editing efficiency at most target sites (Figure 5). On-target activity was drastically reduced when protospacer lengths shorter than 20 nt were used (data not shown).

Figure 5. crRNA with 21mer protospacer lengths provides optimal on-target genome editing. Varying lengths of crRNAs targeting HPRT were reverse transfected, using Lipofectamine® RNAiMAX™ reagent (Thermo Fisher), into a HEK-293–Cas12a cell line that stably expresses Acidaminococcus sp. Cas12a. Genomic DNA was isolated, and genome editing was measured using the Alt-R Genome Editing Detection Kit (T7EI assay) and Fragment Analyzer (Advanced Analytical).

User guides and protocols

Improved enzymes:  The Alt-R Cas12a (Cpf1) enzyme has recently been further optimized to deliver even higher performance. The latest version (V3) can be directly substituted into this protocol in place of the prior Alt-R Cpf1 enzyme.

Frequently asked questions

Webinars

Certificates of analysis (COAs)

Find COAs by batch or lot number

Safety data sheets (SDSs)